negative control shrna sh nc (Genechem)
86
Structured Review
Genechem
negative control shrna sh nc
Negative Control Shrna Sh Nc, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/negative+control+shrna+sh+nc/control+negative/pm42098751-103-9-16
Average 86 stars, based on 1 article reviews
Negative Control Shrna Sh Nc, supplied by Genechem, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/product/negative+control+shrna+sh+nc/control+negative/pm42098751-103-9-16
Average 86 stars, based on 1 article reviews
negative control shrna sh nc - by Bioz Stars,
2026-10
86/100 stars
Images
Related Articles
Expressing:Article Title: Competitive Sequestration of miR-1183 by lncRNA DDX11-AS1 Drives Gliomagenesis through E2F7 Activation Article Snippet: Cells were transiently transfected with indicated miRNA, inhibitor, or plasmid using Lipofectamine 3000 reagent (catalog #L3000015; Thermo Fisher Scientific, Waltham, MA, USA) diluted in Opti-MEM (catalog #L31985070; Thermo Fisher Scientific). .. Lentiviral vectors expressing shRNA targeting DDX11-AS1 (sh-DDX11-AS1) or shRNA:Article Title: Competitive Sequestration of miR-1183 by lncRNA DDX11-AS1 Drives Gliomagenesis through E2F7 Activation Article Snippet: Cells were transiently transfected with indicated miRNA, inhibitor, or plasmid using Lipofectamine 3000 reagent (catalog #L3000015; Thermo Fisher Scientific, Waltham, MA, USA) diluted in Opti-MEM (catalog #L31985070; Thermo Fisher Scientific). .. Lentiviral vectors expressing shRNA targeting DDX11-AS1 (sh-DDX11-AS1) or Article Title: miR-671-5p-enriched exosomes derived from human embryonic stem cells under hypoxia balance oxidative stress homeostasis and macrophage reprogramming to alleviate Legg-Calvé-Perthes disease by targeting NOX2. Article Snippet: Background: Legg-Calvé-Perthes disease (LCPD) remains a pediatric condition that causes hip joint deformities, with complicated pathogenesis.. This study explored the influence of hypoxia-preconditioned human embryonic stem cells (hESCs)-derived exosomes on LCPD and its related mechanism.. Methods: Spontaneously hypertensive rats (SHRs) and High mobility group B1 (HMGB1) -stimulated chondrocytes were used to mimic LCPD disease-like lesion in vivo and in vitro. Article Title: Intratumoral microbiota promote pancreatic cancer progression via NaAc-mediated activation of the GPR43/AMPK/HADH pathway. Article Snippet: .. Short hairpin RNA (shRNA) targeting 3-hydroxyacyl-CoA dehydrogenase (HADH) and Article Title: Ephrin-A4 ligand promotes gastric cancer cell epithelial-mesenchymal transition via the PI3K/AKT signaling pathway Article Snippet: .. For cell transfection, short hairpin RNAs (shRNAs) specifically targeting EFNA4 (shEFNA4#1, TGGAGAGACTTACTACTACAT; shEFNA4#2, CCATGTTCAATTCTCAGAGAA; shEFNA4#3, CTCAACGATTACCTAGACATT) were obtained along with a Negative Control:Article Title: Competitive Sequestration of miR-1183 by lncRNA DDX11-AS1 Drives Gliomagenesis through E2F7 Activation Article Snippet: Cells were transiently transfected with indicated miRNA, inhibitor, or plasmid using Lipofectamine 3000 reagent (catalog #L3000015; Thermo Fisher Scientific, Waltham, MA, USA) diluted in Opti-MEM (catalog #L31985070; Thermo Fisher Scientific). .. Lentiviral vectors expressing shRNA targeting DDX11-AS1 (sh-DDX11-AS1) or Article Title: miR-671-5p-enriched exosomes derived from human embryonic stem cells under hypoxia balance oxidative stress homeostasis and macrophage reprogramming to alleviate Legg-Calvé-Perthes disease by targeting NOX2. Article Snippet: Background: Legg-Calvé-Perthes disease (LCPD) remains a pediatric condition that causes hip joint deformities, with complicated pathogenesis.. This study explored the influence of hypoxia-preconditioned human embryonic stem cells (hESCs)-derived exosomes on LCPD and its related mechanism.. Methods: Spontaneously hypertensive rats (SHRs) and High mobility group B1 (HMGB1) -stimulated chondrocytes were used to mimic LCPD disease-like lesion in vivo and in vitro. Article Title: Intratumoral microbiota promote pancreatic cancer progression via NaAc-mediated activation of the GPR43/AMPK/HADH pathway. Article Snippet: .. Short hairpin RNA (shRNA) targeting 3-hydroxyacyl-CoA dehydrogenase (HADH) and Article Title: Ephrin-A4 ligand promotes gastric cancer cell epithelial-mesenchymal transition via the PI3K/AKT signaling pathway Article Snippet: .. For cell transfection, short hairpin RNAs (shRNAs) specifically targeting EFNA4 (shEFNA4#1, TGGAGAGACTTACTACTACAT; shEFNA4#2, CCATGTTCAATTCTCAGAGAA; shEFNA4#3, CTCAACGATTACCTAGACATT) were obtained along with a Over Expression:Article Title: Competitive Sequestration of miR-1183 by lncRNA DDX11-AS1 Drives Gliomagenesis through E2F7 Activation Article Snippet: Cells were transiently transfected with indicated miRNA, inhibitor, or plasmid using Lipofectamine 3000 reagent (catalog #L3000015; Thermo Fisher Scientific, Waltham, MA, USA) diluted in Opti-MEM (catalog #L31985070; Thermo Fisher Scientific). .. Lentiviral vectors expressing shRNA targeting DDX11-AS1 (sh-DDX11-AS1) or Article Title: miR-671-5p-enriched exosomes derived from human embryonic stem cells under hypoxia balance oxidative stress homeostasis and macrophage reprogramming to alleviate Legg-Calvé-Perthes disease by targeting NOX2. Article Snippet: Background: Legg-Calvé-Perthes disease (LCPD) remains a pediatric condition that causes hip joint deformities, with complicated pathogenesis.. This study explored the influence of hypoxia-preconditioned human embryonic stem cells (hESCs)-derived exosomes on LCPD and its related mechanism.. Methods: Spontaneously hypertensive rats (SHRs) and High mobility group B1 (HMGB1) -stimulated chondrocytes were used to mimic LCPD disease-like lesion in vivo and in vitro. Plasmid Preparation:Article Title: miR-671-5p-enriched exosomes derived from human embryonic stem cells under hypoxia balance oxidative stress homeostasis and macrophage reprogramming to alleviate Legg-Calvé-Perthes disease by targeting NOX2. Article Snippet: Background: Legg-Calvé-Perthes disease (LCPD) remains a pediatric condition that causes hip joint deformities, with complicated pathogenesis.. This study explored the influence of hypoxia-preconditioned human embryonic stem cells (hESCs)-derived exosomes on LCPD and its related mechanism.. Methods: Spontaneously hypertensive rats (SHRs) and High mobility group B1 (HMGB1) -stimulated chondrocytes were used to mimic LCPD disease-like lesion in vivo and in vitro. Infection:Article Title: miR-671-5p-enriched exosomes derived from human embryonic stem cells under hypoxia balance oxidative stress homeostasis and macrophage reprogramming to alleviate Legg-Calvé-Perthes disease by targeting NOX2. Article Snippet: Background: Legg-Calvé-Perthes disease (LCPD) remains a pediatric condition that causes hip joint deformities, with complicated pathogenesis.. This study explored the influence of hypoxia-preconditioned human embryonic stem cells (hESCs)-derived exosomes on LCPD and its related mechanism.. Methods: Spontaneously hypertensive rats (SHRs) and High mobility group B1 (HMGB1) -stimulated chondrocytes were used to mimic LCPD disease-like lesion in vivo and in vitro. Generated:Article Title: Intratumoral microbiota promote pancreatic cancer progression via NaAc-mediated activation of the GPR43/AMPK/HADH pathway. Article Snippet: .. Short hairpin RNA (shRNA) targeting 3-hydroxyacyl-CoA dehydrogenase (HADH) and Transfection:Article Title: Ephrin-A4 ligand promotes gastric cancer cell epithelial-mesenchymal transition via the PI3K/AKT signaling pathway Article Snippet: .. For cell transfection, short hairpin RNAs (shRNAs) specifically targeting EFNA4 (shEFNA4#1, TGGAGAGACTTACTACTACAT; shEFNA4#2, CCATGTTCAATTCTCAGAGAA; shEFNA4#3, CTCAACGATTACCTAGACATT) were obtained along with a |